ID: 1062929149_1062929152

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1062929149 1062929152
Species Human (GRCh38) Human (GRCh38)
Location 10:1340987-1341009 10:1341000-1341022
Sequence CCAGCATCCACCAGAGAACCCTG GAGAACCCTGTGCCCCACATCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 34, 4: 207} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!