ID: 1062939825_1062939842

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1062939825 1062939842
Species Human (GRCh38) Human (GRCh38)
Location 10:1412944-1412966 10:1412983-1413005
Sequence CCGCCCACCCTAATGGAGAGGGG AGGGCTGGCGGGAGGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 161} {0: 1, 1: 2, 2: 18, 3: 371, 4: 11119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!