ID: 1062974566_1062974574

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1062974566 1062974574
Species Human (GRCh38) Human (GRCh38)
Location 10:1674069-1674091 10:1674096-1674118
Sequence CCTGAAGTCGATGTCAGACCTGA TGCAAGGAGGCCACTGGGAACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 45, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!