ID: 1062987278_1062987284

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1062987278 1062987284
Species Human (GRCh38) Human (GRCh38)
Location 10:1780361-1780383 10:1780383-1780405
Sequence CCGGAAGACATGGACTCCAGAGG GAGGCTCCGAACAGCCAGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!