ID: 1062991909_1062991916

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1062991909 1062991916
Species Human (GRCh38) Human (GRCh38)
Location 10:1827227-1827249 10:1827254-1827276
Sequence CCAGCCTCCATGTTGGGAGGAAG GGCCATGTGTGGAGGCATCAGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 37, 3: 149, 4: 476} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!