ID: 1063010067_1063010070

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1063010067 1063010070
Species Human (GRCh38) Human (GRCh38)
Location 10:2012735-2012757 10:2012748-2012770
Sequence CCTGTCCTGGGCTGCCTTTGCTG GCCTTTGCTGGTATTTGCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 340} {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!