ID: 1063042028_1063042029

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1063042028 1063042029
Species Human (GRCh38) Human (GRCh38)
Location 10:2351709-2351731 10:2351725-2351747
Sequence CCGGACGTCACAGGTGTCATTTG TCATTTGCAATCGTGTTCTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!