ID: 1063102578_1063102588

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1063102578 1063102588
Species Human (GRCh38) Human (GRCh38)
Location 10:2963311-2963333 10:2963333-2963355
Sequence CCACACACCTGGCCGCACACCTG GGCCACACACCTGGTGGGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!