ID: 1063123707_1063123710

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1063123707 1063123710
Species Human (GRCh38) Human (GRCh38)
Location 10:3122705-3122727 10:3122731-3122753
Sequence CCTGGGCAGCATTTAGGTTTGAG TGTAGATGGCTCCAGTATACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!