ID: 1063241653_1063241660

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1063241653 1063241660
Species Human (GRCh38) Human (GRCh38)
Location 10:4175812-4175834 10:4175847-4175869
Sequence CCACAGACCTCCATGTGGGCCTG ACACCCATAGAAGGTAGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!