ID: 1063261216_1063261224

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1063261216 1063261224
Species Human (GRCh38) Human (GRCh38)
Location 10:4391691-4391713 10:4391743-4391765
Sequence CCCCAGATCAATGCTCATTTCTG AATGTTATGAAGACTGTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 187} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!