ID: 1063278404_1063278409

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1063278404 1063278409
Species Human (GRCh38) Human (GRCh38)
Location 10:4597197-4597219 10:4597236-4597258
Sequence CCCTGCTCCTGCATCTGCTCCTC ACTTCCTGCTCCCTCTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 114, 4: 1224} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!