ID: 1063280361_1063280367

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1063280361 1063280367
Species Human (GRCh38) Human (GRCh38)
Location 10:4622417-4622439 10:4622449-4622471
Sequence CCTACTTCTAAAAGCATTTAGGG AAACTCTAATAGATCATATCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!