ID: 1063283841_1063283845

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1063283841 1063283845
Species Human (GRCh38) Human (GRCh38)
Location 10:4661662-4661684 10:4661692-4661714
Sequence CCTCCACTCCGTTTGTGTTTCCT CTTGCAGAAGAGCCGTCCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!