ID: 1063342635_1063342646

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1063342635 1063342646
Species Human (GRCh38) Human (GRCh38)
Location 10:5282513-5282535 10:5282553-5282575
Sequence CCCCTGAGCTCCAGACCAAAGCG CCTCCGCTTGGCTGTCTCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!