ID: 1063364197_1063364204

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1063364197 1063364204
Species Human (GRCh38) Human (GRCh38)
Location 10:5479995-5480017 10:5480028-5480050
Sequence CCCCTGCCACTGTGTCTGCACCA ACCACAGCTGTCCCCTGCCACGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 4, 3: 36, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!