ID: 1063365350_1063365363

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1063365350 1063365363
Species Human (GRCh38) Human (GRCh38)
Location 10:5487103-5487125 10:5487150-5487172
Sequence CCCCACGTCCCTTCCTTTCTCTG GTCCTAATCAGCTCAGGCTTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!