ID: 1063366276_1063366286

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1063366276 1063366286
Species Human (GRCh38) Human (GRCh38)
Location 10:5492911-5492933 10:5492961-5492983
Sequence CCAAGAAGTCAAGGACCCCCTGA CTCTTGGTGTGTGTGTGGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 16, 3: 111, 4: 1010}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!