|  | Left Crispr | Right Crispr | 
    
    
      
        | Crispr ID | 1063366278 | 1063366286 | 
      
        | Species | Human (GRCh38) | Human (GRCh38) | 
      
        | Location | 10:5492926-5492948 | 10:5492961-5492983 | 
      
        | Sequence | CCCCCTGACAAGGAAGCTTCAGC | CTCTTGGTGTGTGTGTGGAGTGG | 
      
        | Strand | - | + | 
      
        | Off-target summary | No data | {0: 1, 1: 1, 2: 16, 3: 111, 4: 1010} | 
      
        | Status | Not started | 
    
  
 
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
  
    | Spacer | Left Crispr | Right Crispr | 
  
    |  | Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | 
  
  
    | No off target data available for this pair! |