ID: 1063366278_1063366287

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1063366278 1063366287
Species Human (GRCh38) Human (GRCh38)
Location 10:5492926-5492948 10:5492962-5492984
Sequence CCCCCTGACAAGGAAGCTTCAGC TCTTGGTGTGTGTGTGGAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 122, 4: 1202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!