ID: 1063367179_1063367190

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1063367179 1063367190
Species Human (GRCh38) Human (GRCh38)
Location 10:5498640-5498662 10:5498684-5498706
Sequence CCCTGGAAGCAGGTGGGGGCCCT CACCAAGCACACATGGAACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 315} {0: 1, 1: 0, 2: 2, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!