ID: 1063375004_1063375010

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1063375004 1063375010
Species Human (GRCh38) Human (GRCh38)
Location 10:5549070-5549092 10:5549098-5549120
Sequence CCCAGTTCACTCTAAGTGATTCA GGCGTAAACTCTGAGGGCGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!