ID: 1063417944_1063417966

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1063417944 1063417966
Species Human (GRCh38) Human (GRCh38)
Location 10:5889340-5889362 10:5889389-5889411
Sequence CCCGGGCTGGGCCATCGCCGCGG GCGGGCGGGACACCGGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 189} {0: 1, 1: 0, 2: 1, 3: 22, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!