ID: 1063421699_1063421706

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1063421699 1063421706
Species Human (GRCh38) Human (GRCh38)
Location 10:5917321-5917343 10:5917359-5917381
Sequence CCCTGGCTCCACTGCTGTATGGG CGCAGGGTGCTGCCTTTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 164} {0: 1, 1: 0, 2: 0, 3: 22, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!