ID: 1063429824_1063429842

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1063429824 1063429842
Species Human (GRCh38) Human (GRCh38)
Location 10:5978176-5978198 10:5978224-5978246
Sequence CCTGCTGCAGCTTTGCTCCCCTA GGGGGCGGAGGGGGGAGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 251} {0: 1, 1: 1, 2: 28, 3: 427, 4: 4177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!