ID: 1063462480_1063462487

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1063462480 1063462487
Species Human (GRCh38) Human (GRCh38)
Location 10:6223375-6223397 10:6223427-6223449
Sequence CCAGTGCAGCTGAATCCCTAGAC CCCAACTCTAAGTCACCGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!