ID: 1063504036_1063504049

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1063504036 1063504049
Species Human (GRCh38) Human (GRCh38)
Location 10:6580238-6580260 10:6580272-6580294
Sequence CCGGTGGCGCTGGGACTGCGCGG GGACTGCGCGGGGACTGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 1, 1: 0, 2: 1, 3: 25, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!