ID: 1063612819_1063612828

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1063612819 1063612828
Species Human (GRCh38) Human (GRCh38)
Location 10:7577133-7577155 10:7577183-7577205
Sequence CCAACATGGCACCCCACACAATA GGTTGAACACCATTGGTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126} {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!