ID: 1063714529_1063714539

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1063714529 1063714539
Species Human (GRCh38) Human (GRCh38)
Location 10:8514036-8514058 10:8514070-8514092
Sequence CCATGTCCTGCTTGACCCGCTGC CAGCTCAGACACCTTGGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 9, 3: 38, 4: 201} {0: 1, 1: 1, 2: 10, 3: 41, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!