ID: 1063727690_1063727693

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1063727690 1063727693
Species Human (GRCh38) Human (GRCh38)
Location 10:8656416-8656438 10:8656457-8656479
Sequence CCGGTCAGAGGGCTTATCTCATT ACGTGTGTCATTCACTAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107} {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!