ID: 1063956624_1063956634

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1063956624 1063956634
Species Human (GRCh38) Human (GRCh38)
Location 10:11273314-11273336 10:11273366-11273388
Sequence CCTCCCGTCAGATCAGCGGCAGC TCTAAACTGCACATGCTGAAGGG
Strand - +
Off-target summary {0: 4, 1: 95, 2: 725, 3: 1171, 4: 1567} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!