ID: 1063960041_1063960056

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1063960041 1063960056
Species Human (GRCh38) Human (GRCh38)
Location 10:11299454-11299476 10:11299485-11299507
Sequence CCCCCCAACCCCCCCCAGGAAGG CAGACAGGCTGTCAGTGACATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 69, 4: 652} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!