ID: 1063961507_1063961512

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1063961507 1063961512
Species Human (GRCh38) Human (GRCh38)
Location 10:11309878-11309900 10:11309914-11309936
Sequence CCTTAGGGGAAGTTACAGAGCCC CCTGTCTCTCCCTGCTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!