ID: 1063965750_1063965754

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1063965750 1063965754
Species Human (GRCh38) Human (GRCh38)
Location 10:11344612-11344634 10:11344633-11344655
Sequence CCTTTTCCCCTTCACTGCAGCGT GTCCTTGTGCTGCTTCTCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 25, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!