ID: 1063981498_1063981505

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1063981498 1063981505
Species Human (GRCh38) Human (GRCh38)
Location 10:11455694-11455716 10:11455745-11455767
Sequence CCTATGGAAACCCCAGCAGGCCT TAAGTTATACAGAAATGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 330} {0: 1, 1: 0, 2: 2, 3: 44, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!