ID: 1064128406_1064128410

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1064128406 1064128410
Species Human (GRCh38) Human (GRCh38)
Location 10:12685362-12685384 10:12685413-12685435
Sequence CCTTTAGTTGTAGATAAGTGTTA GAGTTTCTGCATCTTTTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!