ID: 1064176386_1064176390

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1064176386 1064176390
Species Human (GRCh38) Human (GRCh38)
Location 10:13079252-13079274 10:13079267-13079289
Sequence CCTCTCTCATGAGGAGGCACGCG GGCACGCGTTGTGGCCTTAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!