ID: 1064187389_1064187398

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1064187389 1064187398
Species Human (GRCh38) Human (GRCh38)
Location 10:13174262-13174284 10:13174313-13174335
Sequence CCTCTGGAGTAGCATGCCCCACC GAGACAGGGTTTCATCATGATGG
Strand - +
Off-target summary No data {0: 8, 1: 2165, 2: 38663, 3: 92563, 4: 134930}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!