ID: 1064191361_1064191364

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1064191361 1064191364
Species Human (GRCh38) Human (GRCh38)
Location 10:13208691-13208713 10:13208719-13208741
Sequence CCAAAAAAAAGAGGAGGAAGGGG CATAGATTATCCTGCACCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 125, 4: 892} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!