ID: 1064208981_1064208987

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1064208981 1064208987
Species Human (GRCh38) Human (GRCh38)
Location 10:13347830-13347852 10:13347843-13347865
Sequence CCAAGCCCGGCGCTGCCCCTCTC TGCCCCTCTCCAGGCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 487} {0: 1, 1: 1, 2: 6, 3: 44, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!