ID: 1064380459_1064380463

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1064380459 1064380463
Species Human (GRCh38) Human (GRCh38)
Location 10:14837754-14837776 10:14837774-14837796
Sequence CCAGGAGAAGCCAAAGCCGACAG CAGCTGCTGCGCCGCAGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 170} {0: 1, 1: 0, 2: 1, 3: 13, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!