ID: 1064381222_1064381223

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1064381222 1064381223
Species Human (GRCh38) Human (GRCh38)
Location 10:14843411-14843433 10:14843432-14843454
Sequence CCTTTTCAGAGGTGCAGTTGCTC TCCCTGTCAGAGCAGCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202} {0: 1, 1: 1, 2: 1, 3: 27, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!