ID: 1064401853_1064401857 |
View in Genome Browser |
Spacer: -3 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1064401853 | 1064401857 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:15028110-15028132 | 10:15028130-15028152 |
Sequence | CCAGCCACTGACTGCTTAAAAGG | AGGTGGCTTCTTTCTTTGTCTGG |
Strand | - | + |
Off-target summary | {0: 3, 1: 3, 2: 11, 3: 16, 4: 131} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |