ID: 1064423901_1064423906

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1064423901 1064423906
Species Human (GRCh38) Human (GRCh38)
Location 10:15213498-15213520 10:15213550-15213572
Sequence CCAAGCTCCATCAGGGCCTTTTC GAGCCAAAGCCGCGTCGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 248} {0: 1, 1: 0, 2: 0, 3: 1, 4: 11}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!