ID: 1064491400_1064491404 |
View in Genome Browser |
Spacer: -10 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1064491400 | 1064491404 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 10:15860719-15860741 | 10:15860732-15860754 |
| Sequence | CCTTCTTCCTCTACGCACTGCTC | CGCACTGCTCTGGGCTAAGCTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 3, 3: 25, 4: 249} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||