ID: 1064506751_1064506757

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1064506751 1064506757
Species Human (GRCh38) Human (GRCh38)
Location 10:16039330-16039352 10:16039379-16039401
Sequence CCATCTCTACTAAAAATACAAAA ACCTGTAATCCCAGCTACTCGGG
Strand - +
Off-target summary {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551} {0: 29735, 1: 147997, 2: 251626, 3: 208111, 4: 212677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!