ID: 1064506753_1064506766

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1064506753 1064506766
Species Human (GRCh38) Human (GRCh38)
Location 10:16039358-16039380 10:16039411-16039433
Sequence CCAGGCATGTAATTAGCCCACAC CAGGAGGATCGCTTGAACCTGGG
Strand - +
Off-target summary No data {0: 425, 1: 25512, 2: 117129, 3: 214192, 4: 245544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!