ID: 1064517634_1064517641

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1064517634 1064517641
Species Human (GRCh38) Human (GRCh38)
Location 10:16168189-16168211 10:16168230-16168252
Sequence CCATAGTCAAATGTTCAGTTTCC GGCAAGAGCTGTCACTCAAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!