ID: 1064528556_1064528559

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1064528556 1064528559
Species Human (GRCh38) Human (GRCh38)
Location 10:16283695-16283717 10:16283714-16283736
Sequence CCACCTAAGTCCTGGTTAACTAC CTACCTTTTTTCTCAGAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!