ID: 1064528556_1064528567

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1064528556 1064528567
Species Human (GRCh38) Human (GRCh38)
Location 10:16283695-16283717 10:16283745-16283767
Sequence CCACCTAAGTCCTGGTTAACTAC AGGGAGAGATGTGAAGGTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 52, 4: 528}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!